it's a project's review paper which has to be written. The material will be provided by me.
I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG
I need help solving 2 organic chemistry questions for today!
Different research and report on vaccines for viruses
Research on several levels including chromatin organisation, transcription, RNA processing, translation and cis-regulatory elements.
Naming para dos emprendimientos. Ambos nombres deben estar en inglés o bien ser nombres inventados. Ambos nombres están relacionados al cuidado de la salud.
Hello - I am looking for a skilled MEDICAL WRITER with experience in regulatory submissions, Phase 1 through 4 clinical study reports, regulatory submissions, investigator brochures, NDA documents and more. Rare disease writing is a plus but you MUST have at least 3 years experience in oncology writing. You MUST have regulatory writing experience. You must speak and write fluent English. You ...
Hello I need an expert in Organic Chemistry. Please apply if you have the right expertise.
We need to develop an efficient and effective algorithm for facial recognition and Liveness detection with AI capabilities.